pTRE3G-puro_V5-LOV-Turbo2-myc-EGFP
(Plasmid
#253793)
-
PurposeExpress V5-LOV-Turbo2-myc-EGFP under TRE3G (tetracycline inducible) promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE
-
Vector typeMammalian Expression, Lentiviral ; tetracycline inducible promoter
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameV5-LOV-Turbo2-myc-EGFP
-
Alt nameV5-LOV-Tb
-
Alt namemyc-EGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2178
- Promoter pTRE3G
-
Tag
/ Fusion Protein
- V5-LOV-Turbo2-myc-EGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttcctaccctcgtaaa
- 3′ sequencing primer catagcgtaaaaggagcaaca
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTRE3G backbone vector was gift from Alice Y. Ting (Stanford).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.21.693523 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G-puro_V5-LOV-Turbo2-myc-EGFP was a gift from Xinnan Wang (Addgene plasmid # 253793 ; http://n2t.net/addgene:253793 ; RRID:Addgene_253793) -
For your References section:
Optogenetic Proximity Labeling Maps Spatially Resolved Mitochondrial Surface Proteomes and a Locally Regulated Ribosome Pool. Kwak CS, Du Z, Creery JS, Wilkerson EM, Major MB, Elias JE, Wang X. bioRxiv [Preprint]. 2025 Dec 23:2025.12.21.693523. doi: 10.64898/2025.12.21.693523. 10.64898/2025.12.21.693523 PubMed 41497653