pJPC668
(Plasmid
#253814)
-
PurposeFluorescent reporter AmCyan
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMOD_A0000
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 2714
-
Vector typeGolden Gate subcloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAmCyan
-
Alt nameCFP
-
Alt nameCyan Fluorescent Protein
-
SpeciesAnemonia majano
-
Insert Size (bp)690
- Promoter none
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGTTTCGCCACCACTGATTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJPC668 was a gift from Daniel Voytas (Addgene plasmid # 253814 ; http://n2t.net/addgene:253814 ; RRID:Addgene_253814) -
For your References section:
Virus-mediated, heritable gene editing in groundcherry (Physalis grisea). Tibebu R, Ellison EE, Winecke SR, Prichard LE, Klejeski N, Donahue LI, Cody JP, Baysal C, Starker CG, Van Eck J, Voytas DF. Front. Plant Sci. 17:1794888. 10.3389/fpls.2026.1794888