pAP702e
(Plasmid
#253945)
-
PurposePCR donor synthesis for endogenous gene tagging
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXamp
-
Backbone manufacturerGeneArt
- Backbone size w/o insert (bp) 2341
- Total vector size (bp) 3271
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBegin-mNeonGreen:: SV40-NLS::Linker::Nucleoplasmin-NLS::mScarlet::Linker::T2A::Linker
-
SpeciesSynthetic
-
Insert Size (bp)930
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer gcgattaagttgggtaacgc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP702e was a gift from Alexandre Paix (Addgene plasmid # 253945 ; http://n2t.net/addgene:253945 ; RRID:Addgene_253945) -
For your References section:
Cloning-Free Targeting of Endogenous Loci to Generate Fluorescent Reporters in Medaka. Knoblich S, Naruse K, Seleit A, Paix A. Bio Protoc. 2025 Jun 20;15(12):e5360. doi: 10.21769/BioProtoc.5360. eCollection 2025 Jun 20. 10.21769/BioProtoc.5360 PubMed 40620803