Skip to main content
Addgene
Open Menu

pJMR19-ADE2
(Plasmid #254119)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254119 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pJMR19
  • Backbone size w/o insert (bp) 10090
  • Modifications to backbone
    Guide targeting Candidozyma auris ADE2 inserted into guide expression cassette
  • Vector type
    Yeast Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Candidozyma auris ADE2 target sequence
  • gRNA/shRNA sequence
    GCTTTGGACGACCATGTGGA
  • Species
    Candidozyma auris

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LguI (destroyed during cloning)
  • 3′ cloning site LguI (destroyed during cloning)
  • 5′ sequencing primer gggtgtcggttgggttgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Recyclable vector to facilitate genetic manipulation of Candidozyma auris using plasmid encoded Cas9, guide cassette, and nourseothricin resistance cassettes. This vector is loaded with a guide targeting the Candidozyma auris ADE2 gene and can be used as a positive control for transformations.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMR19-ADE2 was a gift from Jeffrey Rybak (Addgene plasmid # 254119 ; http://n2t.net/addgene:254119 ; RRID:Addgene_254119)

  • For your References section:

    A Candidozyma (Candida) auris-Optimized Episomal Plasmid-Induced Cas9-Editing System Reveals the Direct Impact of the S639F-Encoding FKS1 Mutation. Doorley LA, Meza-Perez V, Jones SJ, Rybak JM. J Infect Dis. 2025 Sep 15;232(3):e529-e536. doi: 10.1093/infdis/jiaf285. 10.1093/infdis/jiaf285 PubMed 40569759
Related items: