(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
(Plasmid
#254583)
-
PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 3700
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA with SapI spacer
-
Alt namesingle guide RNA
-
gRNA/shRNA sequenceGGAAGAGCGAGCTCTTCTGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGGCCGCTTTAAGGCCGGTCCTAGCAAGGCCAAGTGGCACCGAGTCGGTGC
-
SpeciesUnspecified
-
Insert Size (bp)130
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry was a gift from Jesse Engreitz (Addgene plasmid # 254583 ; http://n2t.net/addgene:254583 ; RRID:Addgene_254583)