pAAV-hSyn-FLAREmc1
(Plasmid
#254652)
-
PurposeAAV vector for expressing FLAREmc1 sensor under synapsin promotor.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-hSyn
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6281
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFLAREmc1 melanocortin sensor
-
Alt namemouse MC1R with cpGFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1797
- Promoter human synapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgcctgagagcgcagtcgagaaaccggtgccaccatggagacagacacact
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-FLAREmc1 was a gift from Stephane Laporte (Addgene plasmid # 254652 ; http://n2t.net/addgene:254652 ; RRID:Addgene_254652) -
For your References section:
Development of a genetically encoded melanocortin sensor for high sensitivity in vivo imaging. Namkung Y, Slutzki T, Pedroso J, Liu X, Sabatini PV, Kokoeva MV, Laporte SA. Mol Metab. 2025 Nov;101:102254. doi: 10.1016/j.molmet.2025.102254. Epub 2025 Sep 18. 10.1016/j.molmet.2025.102254 PubMed 40975393