Skip to main content
Addgene
Open Menu

PColDuet-nHis-SsDddI.dna
(Plasmid #254901)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254901 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pColADuet-1
  • Backbone manufacturer
    LifescienceMarket, cat. no. PVT0105
  • Backbone size w/o insert (bp) 3665
  • Total vector size (bp) 4127
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    detailed in the attached protocol
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SsDddI
  • Alt name
    DddA immunity protein (DddI)
  • Species
    Simiaoa sunii
  • Insert Size (bp)
    462
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site CATATG (not destroyed)
  • 3′ cloning site CTCGAG (not destroyed)
  • 5′ sequencing primer tcatcatatgcaccatcaccatcatc
  • 3′ sequencing primer cagactcgagttacaattcctcccactcaatac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see the protocol document linked above, in the Resource Information section.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PColDuet-nHis-SsDddI.dna was a gift from Andrew Stergachis (Addgene plasmid # 254901)

  • For your References section:

    Mapping single-cell diploid chromatin fiber architectures using DAF-seq. Swanson EG, Mao Y, Mallory BJ, Vollger MR, Bohaczuk SC, Oliveira CB, Lyon DB, Ranchalis J, Parmalee NL, Cohen BA, Bennett JT, Stergachis AB. Nat Biotechnol. 2025 Dec 3. doi: 10.1038/s41587-025-02914-3. 10.1038/s41587-025-02914-3 PubMed 41339527
Related items: