Skip to main content

pFastBac1_F253Y/F734-hDPP9-6His
(Plasmid #254906)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254906 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pFastBac1
  • Backbone size w/o insert (bp) 4683
  • Total vector size (bp) 7299
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Gentamicin, 100 & 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dipeptidyl peptidase 9
  • Alt name
    DPP9
  • Alt name
    DPRP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2616
  • Mutation
    Changed phenylalanine 253 to tyrosine and phenylalanine 734 to tyrosine
  • GenBank ID
    NM_139159.5
  • Entrez Gene
    DPP9 (a.k.a. DP9, DPLP9, DPP IX, DPRP-2, DPRP2, HATIS, IMD111)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 6His-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TTTGTTCGCCCAGGACTCTAGC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid was originally synthesised by GenScript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac1_F253Y/F734-hDPP9-6His was a gift from Ingrid De Meester (Addgene plasmid # 254906 ; http://n2t.net/addgene:254906 ; RRID:Addgene_254906)
  • For your References section:

    An Interdisciplinary Approach Provides Insights into the Pronounced Selectivity of Compound 42 for DPP9. Beyens O, Corthaut S, Lambeir AM, Van Der Veken P, Sterckx YG, De Meester I, De Winter H. ChemMedChem. 2025 Mar 3;20(5):e202400700. doi: 10.1002/cmdc.202400700. Epub 2024 Nov 27. 10.1002/cmdc.202400700 PubMed 39552560