Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEN_TmiR_G13-L
(Plasmid #25762)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25762 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR1A-Gent
  • Backbone manufacturer
    ATCC 10326362
  • Backbone size w/o insert (bp) 4259
  • Vector type
    Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Growth instructions
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    G alpha 13 miR-shRNA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    22

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site attL1 (not destroyed)
  • 3′ cloning site attL2 (not destroyed)
  • 5′ sequencing primer pCEP-fwd
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Entry vector with TRE-driven G alpha 13 miR-shRNA

G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT

Addgene sequence shows that this plasmid is missing the SpeI site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN_TmiR_G13-L was a gift from Iain Fraser (Addgene plasmid # 25762 ; http://n2t.net/addgene:25762 ; RRID:Addgene_25762)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906