Rix-PGK-Tom-W
(Plasmid
#25813)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25813 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneRix-PGK-W
- Backbone size w/o insert (bp) 6936
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsHB101 or Top10 are recommended for growing lentivector plasmids
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRix-PGK-Tom-W
-
SpeciesRed living color
-
Insert Size (bp)1428
-
MutationtdTomato from Tsien lab
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer aggtggagagagagacagag (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are some discrepancies between Addgene's quality control sequence and the sequence from the depositing lab, but they should not affect the function of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rix-PGK-Tom-W was a gift from Jozsef Kiss & Patrick Salmon (Addgene plasmid # 25813 ; http://n2t.net/addgene:25813 ; RRID:Addgene_25813) -
For your References section:
Expression of FGF-2 in neural progenitor cells enhances their potential for cellular brain repair in the rodent cortex. Dayer AG, Jenny B, Sauvain MO, Potter G, Salmon P, Zgraggen E, Kanemitsu M, Gascon E, Sizonenko S, Trono D, Kiss JZ. Brain. 2007 Nov . 130(Pt 11):2962-76. 10.1093/brain/awm200 PubMed 17728358