pLIX403_HA-SNRPD3_WT
(Plasmid
#258263)
-
PurposeTet-inducible lentivirus expression of N-terminal HA-tagged human SNRPD3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerBroad Institute
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNRPD3
-
Alt nameSmD3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)414
-
Entrez GeneSNRPD3 (a.k.a. SMD3, Sm-D3)
- Promoter TRE promoter, Tet ON
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIX403_HA-SNRPD3_WT was a gift from David Shechter (Addgene plasmid # 258263 ; http://n2t.net/addgene:258263 ; RRID:Addgene_258263) -
For your References section:
Productive mRNA chromatin escape is promoted by PRMT5 activity. DeAngelo JD, Maron MI, Roth JS, Hegde S, Silverstein AM, Gupta V, Stransky S, Basken J, Azofeifa J, Query CC, Sidoli S, Gamble MJ, Shechter D. Mol Cell. 2025 Nov 6;85(21):4016-4031.e9. doi: 10.1016/j.molcel.2025.09.021. Epub 2025 Oct 13. 10.1016/j.molcel.2025.09.021 PubMed 41086806