pMBD-Gate4
(Plasmid
#25960)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBIND
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6360
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsStrain (ccdB Survival Strain): F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG fhuA::IS2 ; Growth condition: 37°C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
-
Insert Size (bp)1711
-
Tag
/ Fusion Protein
- GAL4 Fusion Protein (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer TGCCGTCACAGATAGATTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMBD-Gate4 was a gift from Kamil Onder (Addgene plasmid # 25960 ; http://n2t.net/addgene:25960 ; RRID:Addgene_25960) -
For your References section:
Coupled yeast 2-hybrid-mammalian 2-hybrid reading-frame-independent and site-specific recombinational cloning vector system. Maier CJ, Maier RH, Hintner H, Bauer JW, Onder K. Assay Drug Dev Technol. 2010 Oct;8(5):625-9. doi: 10.1089/adt.2009.0266. Epub 2010 Jun 1. 10.1089/adt.2009.0266 PubMed 20515414