Skip to main content

pIS1-mutant RhoA 3'UTR
(Plasmid #26090)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26090 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIS1
  • Backbone manufacturer
    David Bartel, Addgene plasmid # 12179
  • Backbone size w/o insert (bp) 4085
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mutant RhoA 3'UTR
  • Alt name
    mutant RhoA reporter
  • Alt name
    RhoA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1061
  • Mutation
    Both miR-31 binding sites in 3’ UTR mutagenized. Site 1: from ATCTTGC to AGGCGGC. Site 2: from TCTTGC to CGCCGC.
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer Rluc-F (ccaggattcttttccaatgc)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Renilla luciferase reporter controlled by RhoA 3'UTR containing site-directed mutagenized miR-31 binding sites.

There is also a G->A mutation in the insert. The Weinberg lab has determined that this mutation does not affection function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-mutant RhoA 3'UTR was a gift from Bob Weinberg (Addgene plasmid # 26090 ; http://n2t.net/addgene:26090 ; RRID:Addgene_26090)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507