pIS1-mutant RhoA 3'UTR
(Plasmid
#26090)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIS1
-
Backbone manufacturerDavid Bartel, Addgene plasmid # 12179
- Backbone size w/o insert (bp) 4085
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemutant RhoA 3'UTR
-
Alt namemutant RhoA reporter
-
Alt nameRhoA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1061
-
MutationBoth miR-31 binding sites in 3’ UTR mutagenized. Site 1: from ATCTTGC to AGGCGGC. Site 2: from TCTTGC to CGCCGC.
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer Rluc-F (ccaggattcttttccaatgc)
- 3′ sequencing primer EBV-rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Renilla luciferase reporter controlled by RhoA 3'UTR containing site-directed mutagenized miR-31 binding sites.
There is also a G->A mutation in the insert. The Weinberg lab has determined that this mutation does not affection function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS1-mutant RhoA 3'UTR was a gift from Bob Weinberg (Addgene plasmid # 26090 ; http://n2t.net/addgene:26090 ; RRID:Addgene_26090) -
For your References section:
A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507