Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMLLCK-J72031
(Plasmid #26175)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26175 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMLL-CK
  • Backbone size w/o insert (bp) 2852
  • Vector type
    Synthetic Biology ; 2ab assembly vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Other
  • Growth instructions
    Provided in a pir+ strain. Grow at 37C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    C terminal HSV tag
  • Alt name
    Bmll64
  • Alt name
    J72031
  • Insert Size (bp)
    45

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gtatcacgaggcagaatttcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that this plasmid must be grown in both Chloramphenicol and Kanamycin

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLLCK-J72031 was a gift from Christopher Anderson (Addgene plasmid # 26175 ; http://n2t.net/addgene:26175 ; RRID:Addgene_26175)