pMLLCK-K112503
(Plasmid
#26176)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMLL-CK
- Backbone size w/o insert (bp) 2646
-
Vector typeSynthetic Biology ; 2ab assembly vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Other
-
Growth instructionsProvided in a pir+ strain. Grow at 37C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameC terminal myc tag
-
Alt namesca12
-
Alt nameK112503
-
Insert Size (bp)39
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gtatcacgaggcagaatttcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that this plasmid must be grown in both Chloramphenicol and Kanamycin
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLLCK-K112503 was a gift from Christopher Anderson (Addgene plasmid # 26176 ; http://n2t.net/addgene:26176 ; RRID:Addgene_26176)