Skip to main content
Addgene
Open Menu

MSCV-NPM-ALK-IRES-mCherry
(Plasmid #262241)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 262241 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    MSCV
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    mcherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPM-ALK
  • Species
    H. sapiens (human)
  • Entrez Gene
    ALK (a.k.a. ALK1, CD246, NBLST3)
  • Entrez Gene
    NPM1 (a.k.a. B23, NPM)
  • Promoter MSCV 5′ LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer cccttgaacctcctcgttcgacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.02.10.637348 for bioRxiv preprint.

mCherry sequence contains K4M and G5D mutations (relative to NCBI WP_046072766.1), they do not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-NPM-ALK-IRES-mCherry was a gift from Mohamed Fareh (Addgene plasmid # 262241 ; http://n2t.net/addgene:262241 ; RRID:Addgene_262241)

  • For your References section:

    Programmable and selective silencing of oncogenic fusion transcripts by CRISPR-Cas13b via breakpoint sequence recognition. Hu 胡文欣 W, Chen 陈竑霖 H, He S, Casan JML, Shembrey C, Li S, Brown LM, Zhao A, Truong L, Buchner I, Vassiliadis D, Hughes TP, White DL, Carmichael CL, De Weck A, Voskoboinik I, Gouil Q, Trapani JA, Ekert PG, Sadras T, Fareh M. Sci Adv. 2026 Oct 16;12(42):eady0296. doi: 10.1126/sciadv.ady0296. Epub 2026 Oct 16. 10.1126/sciadv.ady0296 PubMed 42886793
Related items: