pXN-FBLWLF-GAL4DBD
(Plasmid
#26264)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXN-FBLWLF
- Backbone size w/o insert (bp) 8757
-
Vector typeBacterial Expression, Insect Expression ; Drosophila transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZIP- Gal4DBD
-
Alt nameRR12EE345L-Gal4DBD
-
Alt nameGAL4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)640
-
Entrez GeneGAL4 (a.k.a. YPL248C, GAL81)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CAGTGCACGTTTGCTTGTTGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypActPL-Gal4DBD (obtained from Addgene)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Luan et al. Neuron. 2006 Nov 9. 52(3):425-36.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXN-FBLWLF-GAL4DBD was a gift from Tom Clandinin (Addgene plasmid # 26264 ; http://n2t.net/addgene:26264 ; RRID:Addgene_26264) -
For your References section:
A versatile in vivo system for directed dissection of gene expression patterns. Gohl DM, Silies MA, Gao XJ, Bhalerao S, Luongo FJ, Lin CC, Potter CJ, Clandinin TR. Nat Methods. 2011 Mar;8(3):231-7. doi: 10.1038/nmeth.1561. 10.1038/nmeth.1561 PubMed 21473015