Skip to main content

PSICORhp-mp21(v2)
(Plasmid #26272)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26272 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSicoR
  • Backbone size w/o insert (bp) 7560
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p21 shRNA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    55

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TGCAGGGGAAAGAATAGTAGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The shRNA is directed against the mouse p21 sequence 5'- gcagattggtcttctgcaa -3'.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PSICORhp-mp21(v2) was a gift from Rudolf Jaenisch (Addgene plasmid # 26272 ; http://n2t.net/addgene:26272 ; RRID:Addgene_26272)
  • For your References section:

    Direct cell reprogramming is a stochastic process amenable to acceleration. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP, van Oudenaarden A, Jaenisch R. Nature. 2009 Dec 3. 462(7273):595-601. 10.1038/nature08592 PubMed 19898493