Skip to main content

pGL2-hOct4 DE-SV40-Luc
(Plasmid #26279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL2-SV40-Luc
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct4 Distal Enhancer Element (DE)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2002
  • Mutation
    See Depositor Comments below
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ggtacccattgagtccaaatcct
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone kindly provided from Dr. Ron Mckay and Dr. Paul Tesar

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS identified multiple sequence variants in the insert sequence, relative to the depositor provided sequence. See the sequences page for additional details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL2-hOct4 DE-SV40-Luc was a gift from Rudolf Jaenisch (Addgene plasmid # 26279 ; http://n2t.net/addgene:26279 ; RRID:Addgene_26279)
  • For your References section:

    Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Hanna J, Cheng AW, Saha K, Kim J, Lengner CJ, Soldner F, Cassady JP, Muffat J, Carey BW, Jaenisch R. Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7. 10.1073/pnas.1004584107 PubMed 20442331