PB-U6-gRNA-Ef1a-CRISPRi-blast
(Plasmid #262893)

• Purpose: piggyBac vector to transduce both U6-driven gRNA and Ef1a-driven CRISPRi with blasticidin resistance
• Depositing Lab: Ronald Hart
• Depositing Organization: Rutgers, The State University of New Jersey
  Located in the United States of America
• Publication: piggyBac CRISPRi vector (unpublished)

Backbone

• Vector backbone: piggyBac vector
• Backbone size w/o insert (bp): 4697
• Total vector size (bp): 11281
• Vector type: Mammalian Expression, CRISPR ; piggyBac
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: U6-gRNA Cloning Site (BsmB1 GoldenGate)
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 341
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Gene/Insert 2

• Gene/Insert name: KRAB-dCas9-MeCP2
• Insert Size (bp): 5832
• Promoter: Ef1a
• Tag / Fusion Protein:
  • blasticidin S deaminase (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: iPSC Neurodegenerative Disease Initiative (iNDI) & Michael WardThe piggyBac vector was built from PB-TO-oNgn2 (Addgene plasmid # 198397); Neville Sanjana: The CRISPRi cassette came from lentiCRISPRi(v2)-Blast (Addgene plasmid #170068); Feng Zhang: The U6-gRNA cassette started with pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988), but the BbsI scaffold element was replaced with a new scaffold element including two BsmB1 sites for Golden Gate cloning of gRNA sequences.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry