pJC162.1_pc2RNAi
(Plasmid
#26541)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPR244
- Backbone size w/o insert (bp) 3000
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprohormone convertase 2
-
SpeciesS. mediterranea (planarian)
-
Insert Size (bp)2250
-
GenBank IDBK007043
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GATGAAGATTACATGGATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJC162.1_pc2RNAi was a gift from Phillip Newmark (Addgene plasmid # 26541 ; http://n2t.net/addgene:26541 ; RRID:Addgene_26541) -
For your References section:
Genome-wide analyses reveal a role for peptide hormones in planarian germline development. Collins JJ, Hou X, Romanova EV, Lambrus BG, Miller CM, Saberi A, Sweedler JV, Newmark PA. PLoS Biol. 2010 . 8(10):e1000509. 10.1371/journal.pbio.1000509 PubMed 20967238