-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 26818-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 26818-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.3
- Backbone size w/o insert (bp) 5400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5'UTR-c-MYC-3'UTR
-
Alt namec-myc
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1504
-
MutationSequence begins from second ATG; Synthetic UTR sequences added to c-MYC ORF
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer TK polyA reverse
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that orientation of the insert in pcDNA does not matter -- they were cloned by TA-cloning, and either orientation is fine.
Comment from lab: "with reference to NM_002467.4 sequence we have two mutations at following positions: 172 (A to G) and 174 (C to G) there is some confusion as to what the ref seq is exactly but these are the constructs that we've been using successfully."
Please note that the 5'UTR and 3'UTR sequences are synthetic and were added to the c-MYC ORF as described in Figure S1 and Table S2 of Warren et al., Cell Stem Cell. 2010. These UTR sequences are not endogenous c-MYC UTR sequences.
The 5' UTR sequence (including T7 promoter) is: TGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAG
AGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG
The 3' UTR sequence is: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCT
CCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAA
GTGAGGGTCTAGAACTAGTGTCGACGC
DNA (Catalog # 26818-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 26818-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.3_c-MYC was a gift from Derrick Rossi (Addgene plasmid # 26818 ; http://n2t.net/addgene:26818 ; RRID:Addgene_26818) -
For your References section:
Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Warren L, Manos PD, Ahfeldt T, Loh YH, Li H, Lau F, Ebina W, Mandal PK, Smith ZD, Meissner A, Daley GQ, Brack AS, Collins JJ, Cowan C, Schlaeger TM, Rossi DJ. Cell Stem Cell. 2010 Nov 5;7(5):618-30. doi: 10.1016/j.stem.2010.08.012. Epub 2010 Sep 30. 10.1016/j.stem.2010.08.012 PubMed 20888316