Skip to main content

pLKO.1-MKL1/2 shRNA
(Plasmid #27161)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27161 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA MKL1+2
  • gRNA/shRNA sequence
    CATGGAGCTGGTGGAGAAGAA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    21

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer hU6-Fwd
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-MKL1/2 shRNA was a gift from Ron Prywes (Addgene plasmid # 27161 ; http://n2t.net/addgene:27161 ; RRID:Addgene_27161)
  • For your References section:

    Activation and repression of cellular immediate early genes by serum response factor cofactors. Lee SM, Vasishtha M, Prywes R. J Biol Chem. 2010 Jul 16. 285(29):22036-49. 10.1074/jbc.M110.108878 PubMed 20466732