LeGO-R
(Plasmid
#27355)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLeGO
- Backbone size w/o insert (bp) 6747
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsAny (like TOP10, XL10-Gold or Stbl)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6 promoter, SFFV promoter, dsRed2
-
Insert Size (bp)678
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAGCTCACAACCCCTCACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe dsRed2 cDNA is from Clontech. The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LeGO-R was a gift from Boris Fehse (Addgene plasmid # 27355 ; http://n2t.net/addgene:27355 ; RRID:Addgene_27355) -
For your References section:
A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis. Weber K, Bartsch U, Stocking C, Fehse B. Mol Ther. 2008 Apr . 16(4):698-706. 10.1038/mt.2008.6 PubMed 18362927