Skip to main content

LeGO-Y
(Plasmid #27357)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27357 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LeGO
  • Backbone size w/o insert (bp) 6747
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Any (like TOP10, XL10-Gold or Stbl)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6 promoter, SFFV promoter, eYFP
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAGCTCACAACCCCTCACTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The eYFP cDNA is from Clontech. The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LeGO-Y was a gift from Boris Fehse (Addgene plasmid # 27357 ; http://n2t.net/addgene:27357 ; RRID:Addgene_27357)
  • For your References section:

    A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis. Weber K, Bartsch U, Stocking C, Fehse B. Mol Ther. 2008 Apr . 16(4):698-706. 10.1038/mt.2008.6 PubMed 18362927