-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP C1
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression ; FRET standard
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCerulean Traf Venus
-
Insert Size (bp)2138
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe 1 (not destroyed)
- 3′ cloning site Bam HI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
FRET standard
Contains TRAF2 nucleotides 874-1561 from NM_021138.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CTV was a gift from Steven Vogel (Addgene plasmid # 27803 ; http://n2t.net/addgene:27803 ; RRID:Addgene_27803) -
For your References section:
Energy migration alters the fluorescence lifetime of Cerulean: implications for fluorescence lifetime imaging Forster resonance energy transfer measurements. Koushik SV, Vogel SS. J Biomed Opt. 2008 May-Jun;13(3):031204. doi: 10.1117/1.2940367. 10.1117/1.2940367 PubMed 18601528
Map uploaded by the depositor.
