V-Kras
(Plasmid
#27806)
-
Depositing Lab
-
Depositing OrganizationNational Institute on Alcohol Abuse & Alcoholism (NIAAA)
Located in the United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27806 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 27806-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 27806-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP N1
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus kras
-
SpeciesYellow Varient
-
Insert Size (bp)720
-
GenBank IDU55763
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe 1 (not destroyed)
- 3′ cloning site Bam HI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
K-Ras membrane targeting sequence is nucleotides 490-564 from AF493917
DNA (Catalog # 27806-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 27806-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V-Kras was a gift from Steven Vogel (Addgene plasmid # 27806 ; http://n2t.net/addgene:27806 ; RRID:Addgene_27806) -
For your References section:
Energy migration alters the fluorescence lifetime of Cerulean: implications for fluorescence lifetime imaging Forster resonance energy transfer measurements. Koushik SV, Vogel SS. J Biomed Opt. 2008 May-Jun;13(3):031204. doi: 10.1117/1.2940367. 10.1117/1.2940367 PubMed 18601528
Map uploaded by the depositor.