Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

mVenus C1
(Plasmid #27794)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 27794 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 27794-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEYFP C1
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus C1
  • Alt name
    mVenus-C1
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct was created by mutagenesis of pEYFP-C1. When compared with EYFP, Venus contains the following mutations: F46L, F64L, M153T, V163A and S175G. This construct also contains A206K mutation to create a monomeric form of the fluorescent protein.

This plasmid contains a MCS downstream of mVenus so that a gene of interest can be cloned to create a fusion protein with an N-terminal mVenus tag.

Information for Cloning Grade DNA (Catalog # 27794-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mVenus C1 was a gift from Steven Vogel (Addgene plasmid # 27794 ; http://n2t.net/addgene:27794 ; RRID:Addgene_27794)
  • For your References section:

    Cerulean, Venus, and VenusY67C FRET reference standards. Koushik SV, Chen H, Thaler C, Puhl HL, Vogel SS. Biophys J. 2006 Dec 15. 91(12):L99-L101. 10.1529/biophysj.106.096206 PubMed 17040988