-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 28104 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-Promoter
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5010
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEN 3'UTR
-
Alt namephosphatase and tensin homolog
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2700
-
Entrez GenePten (a.k.a. 2310035O07Rik, A130070J02Rik, B430203M17Rik, MMAC1, PTENbeta, TEP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that Addgene's sequencing result contains a 3 nucleotide deletion (bp# 7639-7641) when compared with GenBank accession number NM_008960.2
PTEN 3'UTR was amplified from Balb/c mouse genomic DNA with the following primer pairs:
F: 5' GCTAGCCCCCCTCCTTG
R: 5' GCTAGCAAAAATAATGAACCTTTTTAATTGTTTAAAGG
PCR products were digested with NheI and subcloned into the XbaI site of the pGL3-promoter vector (Promega)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-PTEN 3'UTR was a gift from Jeffrey Rosen (Addgene plasmid # 28104 ; http://n2t.net/addgene:28104 ; RRID:Addgene_28104) -
For your References section:
A putative role for microRNA-205 in mammary epithelial cell progenitors. Greene SB, Gunaratne PH, Hammond SM, Rosen JM. J Cell Sci. 2010 Feb 15. 123(Pt 4):606-18. 10.1242/jcs.056812 PubMed 20103531