Skip to main content
Addgene

Stagia3
(Plasmid #28177)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 28177 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    SV40 basal promoter-GFP-IRES-AP
  • Backbone manufacturer
    Douglas Kim
  • Backbone size w/o insert (bp) 6355
  • Vector type
    Mammalian Expression ; Chicken expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Stop TATA
  • Alt name
    synthetic polyadenylation terminator
  • Alt name
    TATA box
  • Insert Size (bp)
    256

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not (not destroyed)
  • 3′ cloning site Age1 (not destroyed)
  • 5′ sequencing primer GTTCCGCGCACATTTCCCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Stagia3 was a gift from Connie Cepko (Addgene plasmid # 28177 ; http://n2t.net/addgene:28177 ; RRID:Addgene_28177)
  • For your References section:

    Analysis of thyroid response element activity during retinal development. Billings NA, Emerson MM, Cepko CL. PLoS One. 2010 . 5(10):e13739. 10.1371/journal.pone.0013739 PubMed 21060789