Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
(Plasmid #28289)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28289 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
  • Backbone manufacturer
    Cellecta
  • Backbone size (bp) 7500
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    SURE
  • Growth instructions
    Plasmids need to be grown in OmniMAX 2 T1R (Life Technologies) or SURE (Agilent) Recombination defective E.coli cells. SURE cells are kanamycin and tetracycline resistant. When transforming the SURE strain with plasmids carrying chloramphenicol resistance gene, select for transformants on LB agar plates containing 100 µg/ml chloramphenicol. The SURE strain is resistant (Camr) to concentrations of <40 µg/ml chloramphenicol, but sensitive (Cams) to 100 µg/ml chloramphenicol.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None
  • Alt name
    DECIPHER shRNA Expression Vector

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (BpiI) (not destroyed)
  • 3′ cloning site BbsI (BpiI) (not destroyed)
  • 5′ sequencing primer FwdU6 (CAAGGCTGTTAGAGAGATAATTGGAA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro was a gift from Alex Chenchik & Gus Frangou (Addgene plasmid # 28289 ; http://n2t.net/addgene:28289 ; RRID:Addgene_28289)