-
Purpose(Empty Backbone) 3rd generation lentiviral plasmid; This plasmid is the backbone for the DECIPHER libraries (currently DISCONTINUED)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 28289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
-
Backbone manufacturerCellecta
- Backbone size (bp) 7500
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SURE
-
Growth instructionsPlasmids need to be grown in OmniMAX 2 T1R (Life Technologies) or SURE (Agilent) Recombination defective E.coli cells. SURE cells are kanamycin and tetracycline resistant. When transforming the SURE strain with plasmids carrying chloramphenicol resistance gene, select for transformants on LB agar plates containing 100 µg/ml chloramphenicol. The SURE strain is resistant (Camr) to concentrations of <40 µg/ml chloramphenicol, but sensitive (Cams) to 100 µg/ml chloramphenicol.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
-
Alt nameDECIPHER shRNA Expression Vector
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (BpiI) (not destroyed)
- 3′ cloning site BbsI (BpiI) (not destroyed)
- 5′ sequencing primer FwdU6 (CAAGGCTGTTAGAGAGATAATTGGAA)
- (Common Sequencing Primers)
Resource Information
-
References
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro was a gift from Alex Chenchik & Gus Frangou (Addgene plasmid # 28289 ; http://n2t.net/addgene:28289 ; RRID:Addgene_28289)