Skip to main content

ACAV
(Plasmid #29420)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29420 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3940
  • Vector type
    Mammalian Expression ; Stoichiometry standard

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Amber-Cerulean-Amber-Venus
  • Alt name
    ACAV
  • Insert Size (bp)
    2826

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 1st Amber can be excised using a NheI-BSP E1 double digest; Cerulean by BSP E1-BglII; the 2nd Amber by BglII-SalI and Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.

Due to the multiple fluorescent protein repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACAV was a gift from Steven Vogel (Addgene plasmid # 29420 ; http://n2t.net/addgene:29420 ; RRID:Addgene_29420)
  • For your References section:

    Anomalous surplus energy transfer observed with multiple FRET acceptors. Koushik SV, Blank PS, Vogel SS. PLoS One. 2009 Nov 25;4(11):e8031. doi: 10.1371/journal.pone.0008031. 10.1371/journal.pone.0008031 PubMed 19946626
Commonly requested with: