-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-C1
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTPX2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2300
-
Entrez GeneTPX2 (a.k.a. C20orf1, C20orf2, DIL-2, DIL2, FLS353, GD:C20orf1, HCA519, HCTP4, REPP86, p100)
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-TPX2 was a gift from Patricia Wadsworth (Addgene plasmid # 31227 ; http://n2t.net/addgene:31227 ; RRID:Addgene_31227) -
For your References section:
Poleward transport of TPX2 in the mammalian mitotic spindle requires dynein, Eg5, and microtubule flux. Ma N, Tulu US, Ferenz NP, Fagerstrom C, Wilde A, Wadsworth P. Mol Biol Cell. 2010 Mar 15. 21(6):979-88. 10.1091/mbc.e09-07-0601 PubMed 20110350