Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmCherry-TPX2
(Plasmid #31227)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31227 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TPX2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2300
  • Entrez Gene
    TPX2 (a.k.a. C20orf1, C20orf2, DIL-2, DIL2, FLS353, GD:C20orf1, HCA519, HCTP4, REPP86, p100)
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-TPX2 was a gift from Patricia Wadsworth (Addgene plasmid # 31227 ; http://n2t.net/addgene:31227 ; RRID:Addgene_31227)
  • For your References section:

    Poleward transport of TPX2 in the mammalian mitotic spindle requires dynein, Eg5, and microtubule flux. Ma N, Tulu US, Ferenz NP, Fagerstrom C, Wilde A, Wadsworth P. Mol Biol Cell. 2010 Mar 15. 21(6):979-88. 10.1091/mbc.e09-07-0601 PubMed 20110350