- 
            Purpose(Empty Backbone)
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepMG10
- Backbone size (bp) 6536
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameNone
- 
                  Alt nameCMV-FokI (+)-T2A-FokI (-)
- 
    
        Tag
        / Fusion Protein
    - 3xFLAG (N terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI for ZF1/ XbaI for ZF2 (destroyed during cloning)
- 3′ cloning site BglII for ZF1/ BamHI for ZF2 (destroyed during cloning)
- 5′ sequencing primer GCGGTAGGCGTGTACGGT
- 3′ sequencing primer CTGGCAATTTCAATTAATTCAATAT (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made by"+" and "-" FokI heterodimer mutations are derived from Miller et al., Nat. Biotech 2007, PMID 17603475.
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The ‘2-in-1’ ZFN cassette in this plasmid is under control of a CMV promoter. Each ZFN contains an N-terminal triple FLAG tag. The ZFN subunits are separated by a sequence encoding the T2A autoproteinase
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pMG10 was a gift from Keith Joung (Addgene plasmid # 31238 ; http://n2t.net/addgene:31238 ; RRID:Addgene_31238)
- 
                For your References section: Autonomous zinc-finger nuclease pairs for targeted chromosomal deletion. Soellu C, Pars K, Cornu TI, Thibodeau-Beganny S, Maeder ML, Joung JK, Heilbronn R, Cathomen T. Nucleic Acids Res. 2010 Dec 1. 38(22):8269-76. 10.1093/nar/gkq720 PubMed 20716517
 
    
 
                         
             
            