Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRLCon1-3180
(Plasmid #31445)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31445 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRL-Con
  • Backbone size w/o insert (bp) 6380
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HNF4A 3'UTR (long)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3180
  • Entrez Gene
    HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taacaccgagttcgtgaaggtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To measure regulatory potential of 3'UTR

Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRLCon1-3180 was a gift from Gerhart Ryffel (Addgene plasmid # 31445 ; http://n2t.net/addgene:31445 ; RRID:Addgene_31445)
  • For your References section:

    A systematic analysis of the 3'UTR of HNF4A mRNA reveals an interplay of regulatory elements including miRNA target sites. Wirsing A, Senkel S, Klein-Hitpass L, Ryffel GU. PLoS One. 2011;6(11):e27438. Epub 2011 Nov 30. 10.1371/journal.pone.0027438 PubMed 22140441