pMXs-B2
(Plasmid
#31706)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs
- Backbone size w/o insert (bp) 4600
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-18b
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)320
-
Entrez GeneMir18b (a.k.a. Mirn18b, mmu-mir-18b)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer gacggcatcgcagcttggat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-B2 was a gift from Duanqing Pei (Addgene plasmid # 31706 ; http://n2t.net/addgene:31706 ; RRID:Addgene_31706) -
For your References section:
MicroRNA cluster 302-367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition. Liao B, Bao X, Liu L, Feng S, Zovoilis A, Liu W, Xue Y, Cai J, Guo X, Qin B, Zhang R, Wu J, Lai L, Teng M, Niu L, Zhang B, Esteban MA, Pei D. J Biol Chem. 2011 May 13. 286(19):17359-64. 10.1074/jbc.C111.235960 PubMed 21454525
Map uploaded by the depositor.