pSRP-mTAZ
(Plasmid
#31795)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSRP
-
Backbone manufacturerDrs. S Lessnick and T. Golub (Dana-Farber Cancer Institute)
-
Vector typeRetroviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTAZ
-
Alt nameWWTR1
-
gRNA/shRNA sequenceGATGAATCCGTCCTCGGTGTTCAAGAGACACCGAGGACGGATTCATC
-
SpeciesM. musculus (mouse)
- Promoter RNA Pol-III
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer H1 (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSRP-mTAZ was a gift from Michael Yaffe (Addgene plasmid # 31795 ; http://n2t.net/addgene:31795 ; RRID:Addgene_31795) -
For your References section:
TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Hong JH, Hwang ES, McManus MT, Amsterdam A, Tian Y, Kalmukova R, Mueller E, Benjamin T, Spiegelman BM, Sharp PA, Hopkins N, Yaffe MB. Science. 2005 Aug 12;309(5737):1074-8. 10.1126/science.1110955 PubMed 16099986