-
PurposeFor fusion of TagRFP657 to N-term of insert. SEE DEPOSITOR COMMENTS BELOW.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneC1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3983
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagRFP657
-
Insert Size (bp)735
-
MutationM44Q, K69H, F84W, S148H, S165T, D166A, M167L, L181F, and R203Y compared to mKate (but numbering is relative to common EGFP); SEE DEPOSITOR COMMENTS BELOW
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is an additional E10D amino acid change in Addgene's quality control sequence, the full plasmid sequence is assembled and may contain slight discrepancies. According to Dr. Verkhusha, this mutation should not change any properties of the TagRFP657 protein.
**NOTE**: Addgene NGS results indicate that the TagRFP657 ORF is duplicated. In order to remove the duplicated ORF and restore the MCS, recipient scientists can cut with BglII, gel purify the large band, and re-ligate the vector. Alternatively, BglII can be used as the 5' restriction site for cloning, with the 3' site being located in the MCS.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTagRFP657-C1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31872 ; http://n2t.net/addgene:31872 ; RRID:Addgene_31872) -
For your References section:
Far-red fluorescent protein excitable with red lasers for flow cytometry and superresolution STED nanoscopy. Morozova KS, Piatkevich KD, Gould TJ, Zhang J, Bewersdorf J, Verkhusha VV. Biophys J. 2010 Jul 21;99(2):L13-5. 10.1016/j.bpj.2010.04.025 PubMed 20643047