Skip to main content

pTagRFP657-C1
(Plasmid #31872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3983
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagRFP657
  • Insert Size (bp)
    735
  • Mutation
    M44Q, K69H, F84W, S148H, S165T, D166A, M167L, L181F, and R203Y compared to mKate (but numbering is relative to common EGFP); SEE DEPOSITOR COMMENTS BELOW

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There is an additional E10D amino acid change in Addgene's quality control sequence, the full plasmid sequence is assembled and may contain slight discrepancies. According to Dr. Verkhusha, this mutation should not change any properties of the TagRFP657 protein.

**NOTE**: Addgene NGS results indicate that the TagRFP657 ORF is duplicated. In order to remove the duplicated ORF and restore the MCS, recipient scientists can cut with BglII, gel purify the large band, and re-ligate the vector. Alternatively, BglII can be used as the 5' restriction site for cloning, with the 3' site being located in the MCS.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTagRFP657-C1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31872 ; http://n2t.net/addgene:31872 ; RRID:Addgene_31872)
  • For your References section:

    Far-red fluorescent protein excitable with red lasers for flow cytometry and superresolution STED nanoscopy. Morozova KS, Piatkevich KD, Gould TJ, Zhang J, Bewersdorf J, Verkhusha VV. Biophys J. 2010 Jul 21;99(2):L13-5. 10.1016/j.bpj.2010.04.025 PubMed 20643047