Skip to main content

pPSmOrange-Tubulin
(Plasmid #31919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31919 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pC1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PSmOrange
  • Insert Size (bp)
    708
  • Mutation
    S21T, Q63L, F100Y, L125M, K166R, P192S in PSmOrange (mutations are relative to mOrange but numbering is relative to EGFP)
  • Tag / Fusion Protein
    • Tubulin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CGGTAGGCGTGTACGGTGGGAG
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPSmOrange-Tubulin was a gift from Vladislav Verkhusha (Addgene plasmid # 31919 ; http://n2t.net/addgene:31919 ; RRID:Addgene_31919)
  • For your References section:

    A photoswitchable orange-to-far-red fluorescent protein, PSmOrange. Subach OM, Patterson GH, Ting LM, Wang Y, Condeelis JS, Verkhusha VV. Nat Methods. 2011 Jul 31;8(9):771-7. doi: 10.1038/nmeth.1664. 10.1038/nmeth.1664 PubMed 21804536