Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP-STAG2-wildtype
(Plasmid #31972)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31972 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4727
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human STAG2 cDNA
  • Alt name
    stromal antigen 2
  • Alt name
    SA-2
  • Species
    H. sapiens (human)
  • Mutation
    wild-type
  • Entrez Gene
    STAG2 (a.k.a. SA-2, SA2, SCC3B, bA517O1.1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • EGFP (N terminal on backbone)
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GFP-Fwd [CATGGTCCTGCTGGAGTTCGTG]
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-STAG2-wildtype was a gift from Todd Waldman (Addgene plasmid # 31972 ; http://n2t.net/addgene:31972 ; RRID:Addgene_31972)
  • For your References section:

    Mutational inactivation of STAG2 causes aneuploidy in human cancer. Solomon DA, Kim T, Diaz-Martinez LA, Fair J, Elkahloun AG, Harris BT, Toretsky JA, Rosenberg SA, Shukla N, Ladanyi M, Samuels Y, James CD, Yu H, Kim JS, Waldman T. Science. 2011 Aug 19;333(6045):1039-43. 10.1126/science.1203619 PubMed 21852505