-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJFRC4-3XUAS-IVS-mCD8::GFP
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlippase2::PEST
-
SpeciesS. cerevisiae (budding yeast)
-
MutationGlycine at Amino Acid 5
-
Tag
/ Fusion Protein
- PEST (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho (not destroyed)
- 3′ cloning site Xba (not destroyed)
- 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC151-3XUAS-IVS-Flp2::PEST was a gift from Gerald Rubin (Addgene plasmid # 32133 ; http://n2t.net/addgene:32133 ; RRID:Addgene_32133) -
For your References section:
Multiple new site-specific recombinases for use in manipulating animal genomes. Nern A, Pfeiffer BD, Svoboda K, Rubin GM. Proc Natl Acad Sci U S A. 2011 Aug 9. 10.1073/pnas.1111704108 PubMed 21831835