pENTR/U6 HDAC4 shRNA
(Plasmid
#32220)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepENTR/U6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2854
-
Vector typeRNAi ; Gateway U6 ENTRY Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA against murine HDAC4
-
gRNA/shRNA sequenceGGTACAATCTCTCTGCCAAATCGAAATTTGGCAGAGAGATTGTACC
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_207225
-
Entrez GeneHdac4 (a.k.a. 4932408F19Rik, HD4)
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer M13for-20 (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR/U6 HDAC4 shRNA was a gift from Reuben Shaw (Addgene plasmid # 32220 ; http://n2t.net/addgene:32220 ; RRID:Addgene_32220) -
For your References section:
Class IIa histone deacetylases are hormone-activated regulators of FOXO and mammalian glucose homeostasis. Mihaylova MM, Vasquez DS, Ravnskjaer K, Denechaud PD, Yu RT, Alvarez JG, Downes M, Evans RM, Montminy M, Shaw RJ. Cell. 2011 May 13;145(4):607-21. 10.1016/j.cell.2011.03.043 PubMed 21565617