pGL3Basic-miR126-EGFL7-Promoter
(Plasmid
#32244)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCTGCTGCCAACTTGTTCT
- 3′ sequencing primer ATGGACCCTAGCCCTTGCTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3Basic-miR126-EGFL7-Promoter was a gift from Charles Lowenstein (Addgene plasmid # 32244 ; http://n2t.net/addgene:32244 ; RRID:Addgene_32244) -
For your References section:
Ets-1 and Ets-2 regulate the expression of microRNA-126 in endothelial cells. Harris TA, Yamakuchi M, Kondo M, Oettgen P, Lowenstein CJ. Arterioscler Thromb Vasc Biol. 2010 Oct;30(10):1990-7. Epub 2010 Jul 29. 10.1161/ATVBAHA.110.211706 PubMed 20671229