pGL3Basic-miR126-EGFL7-Promoter
(Plasmid #32244)

• Depositing Lab: Charles Lowenstein
• Publication: Harris et al Arterioscler Thromb Vasc Biol. 2010 Oct;30(10):1990-7. Epub 2010 Jul 29.

Backbone

• Vector backbone: pGL3Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: miR-126 Promoter 5' UTR
• Alt name: EGFL7 Promoter 5' UTR
• Species: H. sapiens (human)
• Insert Size (bp): 1770
• Mutation: Promoter region 5' UTR
• Entrez Gene: MIR126 (a.k.a. MIRN126, miRNA126, mir-126)
• Entrez Gene: EGFL7 (a.k.a. NEU1, VE-STATIN, ZNEU1)
• Promoter: 5' UTR

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCCTGCTGCCAACTTGTTCT
• 3′ sequencing primer: ATGGACCCTAGCCCTTGCTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry