Skip to main content

pMS33
(Plasmid #32296)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32296 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMS26
  • Backbone size w/o insert (bp) 13150
  • Modifications to backbone
    USERBstBI fragment replaced with lacZ amplicon
  • Vector type
    Bacterial Expression ; bacterial gene addition

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    Following transformation and plating on rich Ampicillin (100 ug/ml) at 30C, restreak at 42C without drug on plates containing rhamnose and Xgal to obtain strains with insertion of mTn7(phi-lacZMS33) into attTn7
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    lacZ ORF with short 5'UTR
  • Species
    E. coli
  • Insert Size (bp)
    3204
  • GenBank ID
    AAC73447.1 Gene ID: 945006
  • Promoter rhaBp

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site USERBstBI (destroyed during cloning)
  • 3′ cloning site USERBstBI (destroyed during cloning)
  • 5′ sequencing primer GATCTAAACTATGACAATAAAG
  • 3′ sequencing primer na
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Amplification and sequencing primers for verifying insertion into attTn7:

glmS-proximal (Tn7R side)
5’-AATCTGTAACGTTCCGGGTTC-3’ OR
5'-GATGCTGGTGGCGAAGCTGT-3'

pstS-proximal (Tn7L side)
5’-CATTAATAACGAAGAGATGAC-3’ OR
5'-GATGACGGTTTGTCACATGGA-3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMS33 was a gift from Elisabeth Raleigh (Addgene plasmid # 32296 ; http://n2t.net/addgene:32296 ; RRID:Addgene_32296)
  • For your References section:

    A versatile element for gene addition in bacterial chromosomes. Sibley MH, Raleigh EA. Nucleic Acids Res. 2012 Feb;40(3):e19. doi: 10.1093/nar/gkr1085. Epub 2011 Nov 28. 10.1093/nar/gkr1085 PubMed 22123741
Commonly requested with: