pMS34
(Plasmid
#32297)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32297 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMS26
- Backbone size w/o insert (bp) 13150
-
Modifications to backboneUSERBstBI fragment replaced with lacZ amplicon
-
Vector typeBacterial Expression ; bacterial gene addition
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH10B
-
Growth instructionsFollowing transformation and plating on rich Ampicillin (100 ug/ml) at 30C, restreak at 42C without drug on plates containing rhamnose and Xgal to obtain strains with insertion of mTn7(phi-lacZMS33) into attTn7
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namelacZ ORF with long 5'UTR
-
SpeciesEscherichia coli
-
Insert Size (bp)3217
-
GenBank IDAAC73447.1 Gene ID: 945006
- Promoter rhaBp
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site USERBstBI (destroyed during cloning)
- 3′ cloning site USERBstBI (destroyed during cloning)
- 5′ sequencing primer GATCTAAACTATGACAATAAAG
- 3′ sequencing primer na
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Amplification and sequencing primers for verifying insertion into attTn7:
glmS-proximal (Tn7R side)
5’-AATCTGTAACGTTCCGGGTTC-3’ OR
5'-GATGCTGGTGGCGAAGCTGT-3'
pstS-proximal (Tn7L side)
5’-CATTAATAACGAAGAGATGAC-3’ OR
5'-GATGACGGTTTGTCACATGGA-3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS34 was a gift from Elisabeth Raleigh (Addgene plasmid # 32297 ; http://n2t.net/addgene:32297 ; RRID:Addgene_32297) -
For your References section:
A versatile element for gene addition in bacterial chromosomes. Sibley MH, Raleigh EA. Nucleic Acids Res. 2012 Feb;40(3):e19. doi: 10.1093/nar/gkr1085. Epub 2011 Nov 28. 10.1093/nar/gkr1085 PubMed 22123741