Skip to main content

pLKO.shHmga2
(Plasmid #32399)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32399 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO
  • Modifications to backbone
    To knockdown Hmga2 in a metastasis-derived cell line (482N1) pLKO.1 lentiviral vectors targeting Hmga2 were obtained from TRC. The best hairpin sequence targeting Hmga2 was: shHmga2 (TRCN0000265760) 5’GAAACTTATCAAGACGATTAA 3’.
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA targetting Hmga2
  • gRNA/shRNA sequence
    GAAACTTATCAAGACGATTAA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Hmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.shHmga2 was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 32399 ; http://n2t.net/addgene:32399 ; RRID:Addgene_32399)
  • For your References section:

    Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965