-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO
-
Modifications to backboneTo knockdown Hmga2 in a metastasis-derived cell line (482N1) pLKO.1 lentiviral vectors targeting Hmga2 were obtained from TRC. The best hairpin sequence targeting Hmga2 was: shHmga2 (TRCN0000265760) 5’GAAACTTATCAAGACGATTAA 3’.
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targetting Hmga2
-
gRNA/shRNA sequenceGAAACTTATCAAGACGATTAA
-
SpeciesM. musculus (mouse)
-
Entrez GeneHmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.shHmga2 was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 32399 ; http://n2t.net/addgene:32399 ; RRID:Addgene_32399) -
For your References section:
Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965