-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAtaxin-1
-
Alt nameATXN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2604
-
Mutationinsert contains a stretch of 52 Glutamines and no stop codon
-
GenBank IDNM_000332
-
Entrez GeneATXN1 (a.k.a. ATX1, D6S504E, SCA1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-ATXN1-52Q was a gift from Huda Zoghbi (Addgene plasmid # 32492 ; http://n2t.net/addgene:32492 ; RRID:Addgene_32492) -
For your References section:
Chaperone suppression of aggregation and altered subcellular proteasome localization imply protein misfolding in SCA1. Cummings CJ, Mancini MA, Antalffy B, DeFranco DB, Orr HT, Zoghbi HY. Nat Genet. 1998 Jun;19(2):148-54. 10.1038/502 PubMed 9620770