Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32492)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 32492 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    insert contains a stretch of 52 Glutamines and no stop codon
  • GenBank ID
  • Entrez Gene
    ATXN1 (a.k.a. ATX1, D6S504E, SCA1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-ATXN1-52Q was a gift from Huda Zoghbi (Addgene plasmid # 32492 ; ; RRID:Addgene_32492)
  • For your References section:

    Chaperone suppression of aggregation and altered subcellular proteasome localization imply protein misfolding in SCA1. Cummings CJ, Mancini MA, Antalffy B, DeFranco DB, Orr HT, Zoghbi HY. Nat Genet. 1998 Jun;19(2):148-54. 10.1038/502 PubMed 9620770