This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCDF1-PTPRD-G1707R
(Plasmid #32526)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32526 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDF1-MCS2-EF1-Puro
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 6606
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein tyrosine phosphatase receptor-type delta G1707R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5140
  • Mutation
    G1707R
  • GenBank ID
    BC106714
  • Entrez Gene
    PTPRD (a.k.a. HPTP, HPTPD, HPTPDELTA, PTPD, RPTPDELTA)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer atccacgctgttttgacctc
  • 3′ sequencing primer ccaacttctcggggactgt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Todd Waldman
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF1-PTPRD-G1707R was a gift from Todd Waldman (Addgene plasmid # 32526 ; http://n2t.net/addgene:32526 ; RRID:Addgene_32526)
  • For your References section:

    Mutational inactivation of PTPRD in glioblastoma multiforme and malignant melanoma. Solomon DA, Kim JS, Cronin JC, Sibenaller Z, Ryken T, Rosenberg SA, Ressom H, Jean W, Bigner D, Yan H, Samuels Y, Waldman T. Cancer Res. 2008 Dec 15. 68(24):10300-6. 10.1158/0008-5472.CAN-08-3272 PubMed 19074898